Karakterisasi Molekuler Ikan Teri (Stolephorus Commersonnii) di Segara Anakan Cilacap Berdasarkan Marka Pcr-Rflp Gen Sitokrom C Oksidase 1 (Co1)

DEWI, Rani Eva (2018) Karakterisasi Molekuler Ikan Teri (Stolephorus Commersonnii) di Segara Anakan Cilacap Berdasarkan Marka Pcr-Rflp Gen Sitokrom C Oksidase 1 (Co1). Skripsi thesis, Universitas Jenderal Soedirman.

[img] PDF (Cover)
Cover_Rani Eva Dewi_B1J014045.pdf

Download (210kB)
[img] PDF (Legalitas)
Legalitas_Rani Eva Dewi_B1J014045.pdf
Restricted to Repository staff only

Download (598kB)
[img] PDF (Abstrak)
Abstrak_Rani Eva Dewi_B1J014045.pdf

Download (243kB)
[img] PDF (BabI)
Bab I_Rani Eva Dewi_B1J014045.pdf
Restricted to Repository staff only

Download (298kB)
[img] PDF (BabII)
Bab II_Rani Eva Dewi_B1J014045.pdf
Restricted to Repository staff only

Download (280kB)
[img] PDF (BabIII)
Bab III_Rani Eva Dewi_B1J014045.pdf
Restricted to Repository staff only

Download (227kB)
[img] PDF (BabIV)
Bab IV_Rani Eva Dewi_B1J014045.pdf
Restricted to Repository staff only

Download (618kB)
[img] PDF (BabV)
Bab V_Rani Eva Dewi_B1J014045.pdf
Restricted to Repository staff only

Download (198kB)
[img] PDF (DaftarPustaka)
Daftar Pustaka_Rani Eva Dewi_B1J014045.pdf

Download (217kB)
[img] PDF (Lampiran)
Lampiran_Rani Eva Dewi_B1J014045.pdf
Restricted to Repository staff only

Download (230kB)


Ikan teri (Stolephorus commersonnii) merupakan jenis ikan pelagis kecil yang hidup secara berkelompok dan keberadaannya cukup melimpah di Segara Anakan Cilacap. Ikan teri banyak dimanfaatkan sebagai bahan makanan sehingga memiliki nilai komersial yang tinggi. Namun, hal tersebut menyebabkan laju eksploitasi yang tinggi terhadap populasi ikan teri. Secara molekuler, eksploitasi dapat berakibat pada penurunan keragaman genetik suatu populasi. Umumnya populasi yang tereksploitasi memiliki keragaman genetik yang rendah. Penelitian ini bertujuan untuk mengetahui polimorfisme, keragaman haplotipe dan keragaman lokus marka PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) gen CO1 pada populasi ikan teri di Segara Anakan Cilacap. Penelitian ini dilakukan mulai Januari - April 2018 dan menggunakan metode surveyteknik random sampling. Sebanyak 30 sampel ikan teri diambil secara acak dari koleksi Laboratorium Taksonomi Hewan. Genom mtDNA diisolasi menggunakan metode Chelex. Gen Sitokrom C Oksidase 1 (CO1) diamplifikasi dengan teknik PCR. Primer yang digunakan adalah sepasang internal forward primer 5'ATCTTTGGTGCATGAGCAGGAATAGT3' dan primer FishR2 reverse5'ACTTCAGGGTGACCGAAGAATCAGAA3'. Pada tahap skrining, produk PCR sepanjang 650 pasang basa (pb) dipotong dengan delapan enzim restriksi HpyF31, HinfI, PstI, EcoRI, HindIII, RsaI, VspI dan TaqI. Skrining enzim dilakukan untuk mendapatkan enzim yang mampu memotong gen CO1 ikan teri. Marka spesifik PCR-RFLP dianalisis secara deskriptif berdasarkan kemunculan pola pita DNA pada gel agarose 1%. Hasil penelitian menunjukkan terdapat empat enzim (HpyF31, HinfI, PstI, dan EcoRI) yang tidak dapat memotong gen CO1. Empat enzim lain (HindIII, RsaI, VspI dan TaqI) mampu memotong gen CO1. Enzim HindIII, VspI dan TaqI mampu mendigesti produk PCR dan menghasilkan dua fragmen RFLP, sedangkan enzim RsaI menghasilkan tiga fragmen RFLP. Enzim HindIII menghasilkan fragmen berukuran 416 bp dan 234 bp, enzim VspI menghasilkan ukuran fragmen 435 bp dan 214 bp, enzim TaqI menghasilkan ukuran fragmen 556 bp dan 94 bp serta enzim RsaI menghasilkan ukuran fragmen 319 bp, 183 bp dan 148 bp. Fragmen RFLP yang dihasilkan tersebut muncul pada semua sampel dan menghasilkan pola pita yang seragam pada semua individu ikan teri.Hal ini menunjukkan bahwa gen CO1 pada populasi ikan teri di Segara Anakan Cilacap bersifat monomorfik karena memiliki alel yang sama. Oleh karena itu, dapat disimpulkan bahwa marka PCR-RFLP gen CO1 ikan teridi Segara Anakan Cilacaptidak dapat memperlihatkan adanya variasi genetik dan menunjukkan nilai keragaman haplotipe sebesar 0 (nol) serta keragaman lokus sebesar 0%.

Item Type: Thesis (Skripsi)
Nomor Inventaris: B18078
Uncontrolled Keywords: commerson’s anchovy, PCR-RFLP, genetic diversity, cytochrome c oxidase 1 gene (CO1)
Subjects: F > F182 Fishes
M > M470 Molecular biology
V > V15 Variation Biology
Divisions: Fakultas Biologi > S1 Biologi
Depositing User: Mr BAYU Ananda
Date Deposited: 27 Jan 2021 08:31
Last Modified: 27 Jan 2021 08:31
URI: http://repository.unsoed.ac.id/id/eprint/7313

Actions (login required)

View Item View Item


Downloads per month over past year